9.2 Key concepts: genetics, HIV structure and life cycle
9.2.1 Recap from previous section
The reading in section 1 introduced some of the practical issues about HIV drug resistance.
9.2.2 Introduction to section 2
For the first proper section we start with basics including important concepts.
This includes an introduction to genetics, how HIV makes copies of itself (when it reproduces or replicates) and how it makes tiny mistakes each time.
9.2.3 Genetics
The structure of things that reproduce, grow and die is usually dependent on genetic material.
This is the case for bacteria, viruses, insects, animals, a tomato, a beanstalk or a human.
This genetic material is usually the double strand of RNA called DNA (see Figure 1).
DNA is like a recipe book for how to make a new organism (tomato/human/virus etc). For humans, DNA is in all of our cells that have a nucleus: in skin cells, bone cells, brain cells, liver cells, blood cells and many others.
The genetic structure of HIV is slightly different because it is single-stranded RNA. Before it can replicate (inside the nucleus of a human cell) it needs to be transformed into double stranded DNA.
HIV does this mainly inside CD4 cells. These are a type of blood cells that are part of the immune system.
DNA is made up of a chain of chemicals called nucleotides (or bases). There are only four bases and the order of the bases determine what they do. The chain of bases are held together by a backbone of two strands of sugar and phosphate molecules. This makes the familiar double helix structure in Figure 1.
Figure 1: Simplified illustrations of DNA
a) Simplified to illustrate bases and backbone.
b) The molecular structure of the bases and the sugar and phosphate groups that form the backbone.

Source: US National Library of Medicine.
Human DNA is a chain of 3,000,000,000 bases (3 billion). The four bases are abbreviated to letters: A (adenine), T (thymine), C (cytosine) and G (guanine).
The code for a human will look very similar (but is much longer):
TACCTTGAGGTGTTGAGGTGCCAAAATGGTGACCCCTTGAG
GTGCCAAAATGGTGTTGAGGTGCCAAAATGGTGACCATTGA
GGTGCC AAAATGGTGACCAAAACCATG etc (out to 3,000,000,000 letters).
Because DNA is a double strand, this is actually a double chain of 3,000,000,000 base pairs. The pairs always twin A with T, and C with G. So the chain looks like:
T A C C T T G A
I I I I I I I I
A T G G A A C T etc
HIV is a similar chain, but only has about 9,700 bases.
This is the recipe for HIV to replicate. If these letters change for any reason, it is like changing the the recipe. The next generation of HIV will then be slightly different.
Changes in each generation is called evolution. Evolution occurs for every living thing – for humans, tomatoes and viruses.
See Appendix 2 for more information about DNA.
9.2.4: Life cycles and replication
Every living thing, by definition, has a life cycle.
This is repeated from generation to generation. At its most basic, this includes:
- Early development and birth.
- Reproduction, perhaps many times.
- Death.
Replication involves passing genetic material from one generation to the next.
The life cycle for HIV is very fast. HIV in an active CD4 cell only survives for 1–2 days. Over this time, a cell is infected, the virus replicates and then the cell dies.
Infected cells also signal to uninfected cells to die more quickly. In an HIV negative person, CD4 cells live for 3-4 days, so HIV causes all activated CD4 cells to live for a shorter time. However, most of the immune system is resting or asleep. HIV in a resting cell is also resting.
HIV is also very prolific. It replicates a lot!
Each infected CD4 cell produces several hundred new infectious particles of HIV (called virions). (A virus is called a virion when it is not inside a cell).
These virions infect new CD4 cells and the cycle repeats. When not on ART, millions of CD4 cells become infected every day and at least 100 million new HIV virions are produced each day.
HIV has one of the highest and fastest replication rates of all viruses. It replicates a lot in a very short time.
HIV has to reproduce its genetic code which is in the form of a strand of 9,200 bases. Small mistakes in copying the genetic RNA is like print errors in a recipe. Because HIV does not have a way to proofread, mistakes are common. In every reproduction cycle it makes at least one mistake.

By comparison, human DNA replication usually has very accurate proof-reading. If it detects an error it goes back to correct it. In humans an error occurs only once in every 10-100 million bases. In humans, many changes are not important and the role of much of human DNA is not understood. Although 90% of DNA was thought to be junk more recent research thinks it may be more important and that we just have not yet understood it.
If a recipe spelled ‘sugar’ as ‘suger’ you would probably guess right and still make a good cake.
However, if it changed ‘2 eggs’ to ‘20 eggs’ it would be a mess.
With HIV, some changes are important and some make no noticeable difference. Sometimes, one change affects the way a drug works.
The lack of proof reading, together with the vast amount of new viruses produced each day, makes it likely that at least one HIV mutation will be produced in every cycle (when not on treatment).
Sometimes dual mutations may occur on the same strand of HIV. Luckily, even with so much virus being produced triple mutations relating to drug resistance rarely occur by chance.
To understand how different mutations affect drug resistance it is useful to use a different diagram for the structure of HIV. (See Appendix 5 for an illustration of the HIV genome).
This shows the genetic structure of the single strand of RNA for HIV as nine main genes. In order to picture this structure, the genetic structure of HIV RNA that shows each gene, is shown as a block, some of which overlap.
Each of these main genes plays an important role in making new HIV. You don’t need to learn the function of each gene but it is useful to know that they exist.
By comparison, the chains of nucleotides in human DNA is organised into over 20,000 genes (in 23 pairs of chromosomes).
9.2.5 HIV replication
The third point in this section involves combining points one and two:
- HIV is a chain of 9,200 bases that replicates every 1–2 days.
- Even with a viral load of only 10,000 copies/mL, over 100 million new viruses are produced each day.
- Every reproduction cycle includes at least one mistake: somewhere an A could change to a C; or a G to an A etc; just by accident. HIV does not proofread.
Before starting treatment (ie before viral load is dramatically reduced) every single base change is likely to be present. Some of these mutations cause drug resistance.
9.2.6 Section 2: Learning points
- HIV is a virus made up of two single strands of genetic material, called RNA.
- The genetic material in HIV is much shorter than human DNA. It is like comparing a pea to the Titanic.
- The order of the four bases determines everything about the structure of an organism (whether this is a virus, a tomato or a human).
- The lifecycle for HIV is short (only 1-2 days).
- The natural process of replication sometimes involves slight changes to the genetic structure. These are called mutations.
- HIV doesn’t have a way to proofread for these mutations. This means that everyday slightly different new versions of HIV are produced.
- Often these new mutations make no difference, but some can stop an HIV drug from working.
9.2.7 Section 2 evaluation
Please now take a few minutes to evaluate this session online.
This single page includes six short questions.
Last updated: 1 January 2023.